Bibliometric Analysis, Primer Design, and AcFT1 Expression of Shallots under In Vitro Multiplication

Deritha Ellfy Rantau, Siti Noorohmah, Resa Sri Rahayu, Sitti Fatimah Syahid, Betalini Widhi Hapsari, Dyah Retno Wulandari, Eldrian Daffa Raihan, Aufa Rizqia Haz, Ajeng Putri Kumala, Yuliawati Yuliawati, Desriani Desriani

Abstract


The use of botanical seeds of shallot as planting materials is more effective than bulbs. However, the characteristics of plants are not ‘true to type’. Bibliometric analysis can identify areas that have been under- explored. Research on biomolecule compounds and gene expression is needed to support biomarker-based detection technology to predict plant productivity early.  This research aims to study the expression of the AcFT1 gene to compare two shallot plantlets with different responses (non-multiplied and multiplied). The AcFT1 gene was identified by bibliometric analysis. GapC2 (group of housekeeping genes) was selected as an internal control gene. The primer designed result were: AcFT1-F: 5’GCGAGAAACCGTCTGCTATGA3’; AcFT1-R: 5’GCAACTGGA GACCCAAGGTT3’; GapC2-F: 5’GCTGCACAACCAACTGCTTA3’; GapC2-R:  5’CCAGTGCTGCTAGGAATGAT3’. The RNA from micro bulb of shallot was then extracted and converted into cDNA with RT-PCR process. Based on the best-optimized PCR annealing temperature (55.2oC), the GapC2 and AcFT1 genes were expressed at the same thickness for both phenotypes, indicating the same level of expression in both micro bulbs. Further, this showed that AcFT1 cannot be used for comparative multiplication studies, this gene is more related to the bulb formation rather than the multiplication process.

Keywords


AcFT1; Bibliometric analysis; GapC2; In vitro multiplication; True Seed of Shallot

Full Text:

PDF

References


Abdelrahman, M., Ariyanti, N. A., Sawada, Y., Tsuji, F., Hirata, S., Hang, T. T. M., Okamoto, M., Yamada, Y., Tsugawa, H., Hirai, M. Y., & Shigyo, M. (2020). Metabolome-based discrimination analysis of shallot landraces and bulb onion cultivars associated with differences in the amino acid and flavonoid profiles. Molecules, 25(22), 5300. DOI

Adi, D. D., Taopan, R. A., Liana, D., Astuti, T., Dir, I. S., & Alem, M. R. (2023). Teknik pembuatan pupuk bokashi di kelompok tani Nagekeo. JMM (Jurnal Masyarakat Mandiri), 7(3), 2609. DOI

Asif, S., Khan, M., Arshad, M. W., & Shabbir, M. I. (2021). PCR optimization for beginners: step by step guide. Research in Molecular Medicine, 9(2), 81–102. DOI

Bachie, O. G., Santiago, L. S., & McGiffe, M. E. (2019). Physiological responses of onion varieties to varying photoperiod and temperature regimes. Agriculture, 9(10), 214. DOI

Begna, T. (2021). Genotype - environment interaction and stability analysis. International Journal of Agriculture and Biosciences, 10(2), 120–127. website

Bustin, S. A., Mueller, R., & Nolan, T. (2020). Parameters for successful PCR primer design. In R. Biassoni & A. Raso (Eds.), Quantitative Real-Time PCR (Vol. 2065, pp. 5–22). Springer New York. DOI

Driver, J. A., & Kuniyuki, A. H. (1984). In vitro propagation of paradox walnut root stock. HortScience, 19(4), 507–509. DOI

Fairuzia, F., Sobir, S., Maharijaya, A., Ochiai, M., & Yamada, K. (2022). Longday photoperiod accelerates flowering in Indonesian non-flowering shallot variety. AGRIVITA Journal of Agricultural Science, 44(2), 216–224. DOI

Ferjani, A., Tsukagoshi, H., & Vassileva, V. (2023). Editorial: Model organisms in plant science: Arabidopsis thaliana. Frontiers in Plant Science, 14, 1279230. DOI

Guo, L., Ma, F., Wei, F., Fanella, B., Allen, D. K., & Wang, X. (2014). Cytosolic phosphorylating glyceraldehyde-3-phosphate dehydrogenases affect Arabidopsis cellular metabolism and promote seed oil accumulation. The Plant Cell, 26(7), 3023–3035. DOI

Heller, M. (2023). Plant propagation and its advancements in technology. Journal of Horticulture, 10, 324.

Hendling, M., & Barišić, I. (2019). In-silico design of DNA oligonucleotides: Challenges and approaches. Computational and Structural Biotechnology Journal, 17, 1056–1065. DOI

Ishii, T., Suto, M., Suzuki, N., & Ikeda, H. (2022). Growth and gene expression related to bulb development and day-length responses in onion cultivars during over winter cultivation. The Horticulture Journal, 91(4), 514–521. DOI

Joshi, C., Ke, W., Drangowska-way, A., O’Rout, E. J., & Lewis, N. (2022). What are housekeeping genes? Plos Computational Biology, July 13, 1–19. DOI

Kibbe, W. A. (2007). OligoCalc: An online oligonucleotide properties calculator. Nucleic Acids Research, 35, 43–46. DOI

Kim, G., Rim, Y., Cho, H., & Hyun, T. K. (2022). Identification and functional characterization of flowering locus T in Platycodon grandiflorus. Plants, 11(3), 325. DOI

Lokesh, K., Veeregowda, R., & Shekar, G. C. (2020). Seed production potential of long day and intermediate group of onion genotypes as affected by period of cold treatment and growth regulator. The Pharma Innovation Journal, 9(6), 525–527. PDF

Love, K., Paull, R. E., Cho, A., & Kawabata, A. (2017). Tropical fruit propagation guide. Fruit, Nut and Beverage Crops, July, 1–10. PDF

Lyngkhoi, F., Khar, A., Mangal, M., Gaikwad, A. B., & Thirunavukkarasu, N. (2019). Expression analysis and association of bulbing to Flowering Locus T (FT) gene in short day onion (Allium cepa L.). Indian Journal of Genetics and Plant Breeding, 79(01), 77-81. DOI

Matsuse, K., Abdelrahman, M., Ariyanti, N. A., Tsuji, F., Hirata, S., Nakajima, T., Sato, M., Hirai, M. Y., Manochai, B., & Shigyo, M. (2022). Targeted metabolome profiling of Indonesian shallots and Japanese long-day/short-day bulb onions. Metabolites, 12(12), 1260. DOI

Murashige, T., & Skoog, F. (1962). A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum, 15(3), 473–497. DOI

Nastiti, H. R. R., & Kuncara, R. B. (2023). Desain primer untuk deteksi gen diphtheria toxin repressor (dtxR) sebagai biomarker bakteri Corynebacterium diphtheriae menggunakan in silico PCR. Jaringan Laboratorium Medis, 5(2), 136–143. DOI

Prakoso, T., & Alpandari, H. (2021). Potensi penggunaan bahan tanam bawang merah (Allium ascalonicum L.) melalui teknik penanaman TSS (True Shallot Seed). Agrisintech (Journal of Agribusiness and Agrotechnology), 2(2), 59-66. DOI

Rajiman, & Megawati, S. (2022). Viabilitas dan vigor berbagai varietas true shallot seed dengan perendaman jenis zat pengatur tumbuh (ZPT) alami. Agritech, XXIV(2), 131–137. DOI

Ranjbar, M., Khakdan, F., Ghorbani, A., Zargar, M., & Chen, M. (2023). The variations in gene expression of GAPDH in Ocimum basilicum cultivars under drought ‑ induced stress conditions. Environmental Science and Pollution Research, 30(56), 119187–119203. DOI

Rantau, D. E. (2022). Pertumbuhan, perrbanyakan tunas dan perbesaran bulblet tiga kultivar bawang merah dengan bahan tanam TSS (true seed of shallot) secara in vitro. [Master Thesis] IPB University. website

Rashid, Md. H. A., Cheng, W., & Thomas, B. (2019). Temporal and spatial expression of arabidopsis gene homologs control daylength adaptation and bulb formation in onion (Allium cepa L.). Scientific Reports, 9(1), 14629. DOI

Sable, P. A., Wankhade, V. R., & Nandre, B. M. (2020). Propagation by sexual and budding (asexual) methods in horticultural crops. Indian Journal of Pure & Applied Biosciences, 8(2), 259–266. DOI

Sakti, D. M., Tejasukmana, S. U., Kirana, R., Rosliani, R., & Hermanto, C. (2017). Kesamaan genetis tanaman bawang merah yang diperbanyak secara biji dan umbi. Prosiding Seminar Nasional PERIPI-2017 Bogor, 3 Oktober 2017, 587–591. PDF

Sasmito, D. E. K., Kurniawan, R., & Muhimmah, I. (2014). Kaeakteristik primer pada polymerase chain reaction (PCR) untuk sekuensing DNA: Mini review. Seminar Nasional Informatika Medis (SNIMed) V, 93–102. website

Sharma, M. (2020). Basic concept of primer designing: A minireview. International Journal of Latest Trends in Engineering and Technology, 17(4), 10–12. website

Siregar, E. (2019). Perusahaan benih di Belanda bantu petani kembangkan bawang merah - ANTARA News. website

Soliman, M. A., Azab, M. S., Hussein, H. A., Roushdy, M. M., & Abu El-Naga, M. N. (2024). FBPP: Software to design PCR primers and probes for nucleic acid base detection of foodborne pathogens. Scientific Reports, 14(1), 1229. DOI

Sopiana, R., Suwignyo, R. A., Harun, M. U., & Susilawati. (2023). Seedling performance, growth and yield of onion sown by direct seeding in tropical riparian soil. AGRIVITA Journal of Agricultural Science, 45(1). 11-19. DOI

Sun, W., Shahrajabian, M. H., & Cheng. Q. (2019). The insight and survey on medicinal properties and nutritive components of Shallot. Journal of Medicinal Plants Research, 13(18), 452–457. DOI

Syamsidi, A., Aanisah, N., Fiqram, R., & Jultri, I. A. (2021). Primer design and analysis for detection of mecA gene. Journal of Tropical Pharmacy and Chemistry, 5(3), 245–253. DOI

Tribhuvan, K. U., Das, A., Srivastava, H., Kumar, K., Durgesh, K., Sandhya, Mithra, S. V. A., Jain, P. K., & Gaikwad, K. (2020). Identification and characterization of PEBP family genes reveal CcFT8 a probable candidate for photoperiod insensitivity in C. cajan. 3 Biotech, 10(5), 194. DOI

Wang, M., Liu, H., Ren, J., Huang, Y., Deng, Y., Liu, Y., Chen, Z., Chow, F. W.-N., Leung, P. H.-M., & Li, S. (2023). Enzyme-assisted nucleic acid amplification in molecular diagnosis: A review. Biosensors, 13(2), 160. DOI

Wu, Q., Bai, X., Nie, M., Li, L., Luo, Y., Fan, Y., Liu, C., Ye, X., & Zou, L. (2023). Genome-wide identification and expression analysis disclose the pivotal Phosphatidylethanolamine Binding Protein members that may be utilized for yield improvement of Chenopodium quinoa. Frontiers in Plant Science, 13, 1119049. DOI

Yang, Z., Chen, L., Kohnen, M. V., Xiong, B., Zhen, X., Liao, J., Oka, Y., Zhu, Q., Gu, L., Lin, C., & Liu, B. (2019). Identification and characterization of the PEBP family genes in Moso bamboo (Phyllostachys heterocycla). Scientific Reports, 9(1), 14998. DOI

Zhang, M., Li, P., Yan, X., Wang, J., Cheng, T., & Zhang, Q. (2021). Genome ‑ wide characterization of PEBP family genes in nine Rosaceae tree species and their expression analysis in P. mume. BMC Ecology and Evolution, 21(1), 32. DOI

Zhang, Z., Li, C., Zhang, J., Chen, F., Gong, Y., Li, Y., Su, Y., Wei, Y., & Zhao, Y. (2020). Selection of the reference gene for expression normalization in Papaver somniferum L. under abiotic stress and hormone treatment. Genes, 11(2), 124. DOI

Zulfahmi, R., Lestari, M. A., Sari, H. P., & Putrantri, D. A. (2023). Produksi beberapa varietas bawang merah true shallot seed (TSS) terhadap pemberian bokashi. AGRORADIX : Jurnal Ilmu Pertanian, 7(1), 38–42. DOI




DOI: http://doi.org/10.17503/agrivita.v47i1.4548

Copyright (c) 2025 The Author(s)

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.